View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15178_high_48 (Length: 251)
Name: NF15178_high_48
Description: NF15178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15178_high_48 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 141; Significance: 5e-74; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 1 - 149
Target Start/End: Complemental strand, 28122040 - 28121892
Alignment:
| Q |
1 |
tcaatgtaaacaagttttacgcatgcatgtaattatatcttgccatgacgctactttgctgtattgattttcaaaatatctctatgatcaattgtgcgtg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||| |
|
|
| T |
28122040 |
tcaatgtaaacaagttttacgcatgcatgtaattatatcttgccatgacgctactttgctgtattgattttcaaaatatctctatgatcgattgtgtgtg |
28121941 |
T |
 |
| Q |
101 |
taactttttgtttctttctaatcttctaatgtatatgcaatgtatactc |
149 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28121940 |
taactttttgtttctttctaatcttctaatgtatatgcaatgtatactc |
28121892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 212 - 241
Target Start/End: Complemental strand, 28121829 - 28121800
Alignment:
| Q |
212 |
gttgagaaccccgagctaatttgagaataa |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
28121829 |
gttgagaaccccgagctaatttgagaataa |
28121800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University