View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15178_high_52 (Length: 248)
Name: NF15178_high_52
Description: NF15178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15178_high_52 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 163; Significance: 4e-87; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 1 - 206
Target Start/End: Complemental strand, 43201463 - 43201261
Alignment:
| Q |
1 |
accctatttttaattaagtatcatgtacacacattagatcaatataggttgtttactcttacggattaaatattattttgttatgggatgttgcatgcga |
100 |
Q |
| |
|
|||||||||||||||||| || |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
43201463 |
accctatttttaattaaggattatgtacacacattagatcaataa--gttgtttactcttacggattaaatattattttgttatggtatgttgcatgcga |
43201366 |
T |
|
| Q |
101 |
ttttgaattctataatattatagtctgtttgaatgggattatatatttatattagtttaaccactagcattaagtattaatgagagaatactcccttcct |
200 |
Q |
| |
|
|||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
43201365 |
ttttgaattctataattttatagtcggtttgaatgggattatatatttatattagtttaaccactagcattaagtattaatgagagaatact-ccttcct |
43201267 |
T |
|
| Q |
201 |
tccttc |
206 |
Q |
| |
|
|||||| |
|
|
| T |
43201266 |
tccttc |
43201261 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University