View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15178_high_53 (Length: 247)
Name: NF15178_high_53
Description: NF15178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15178_high_53 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 34223573 - 34223812
Alignment:
| Q |
1 |
ccggacatgcagccgattgtcttgacgtgaattttgtccggcgtcgtttctcgccgggacgacgacggcgacaccgtgctgctttgtctcttcattttct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34223573 |
ccggacatgcagccgattgtcttgacgtgaattttgtccggcgtcgtttctcgccgggacgacgacggcgacaccgtgctgctttgtctcttcattttct |
34223672 |
T |
 |
| Q |
101 |
tctcc-ttatgaaagtgagttttggtgagtggtgtaataaagagtataacggttaccacgctgaagaaagaataag--agtagtaaaattaaagtaaagt |
197 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
34223673 |
tctcctttatgaaagtgagttttggtgagtggtgtaataaagagtataacggttaccacgctgaagaaagaataaggtagtagtaaaattaaagtaaagt |
34223772 |
T |
 |
| Q |
198 |
aaattgcacgtggtgtgttaattatcagggttcggttttc |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34223773 |
aaattgcacgtggtgtgttaattatcagggttcggttttc |
34223812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University