View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15178_high_57 (Length: 240)
Name: NF15178_high_57
Description: NF15178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15178_high_57 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 1 - 100
Target Start/End: Complemental strand, 14488635 - 14488537
Alignment:
| Q |
1 |
aataattgtgaaattactgcatatcacaacttttcccttgataaatagaagtttttgagttatgtttaagaaagttggttttcaagatcttgaaatcttc |
100 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
14488635 |
aataattttgaaattactgcatatcacaacttttcccttgataaatagaagtttttgagttatgtgcaagaaagttgg-tttcaagatcttgaaatcttc |
14488537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 175 - 221
Target Start/End: Complemental strand, 14488475 - 14488429
Alignment:
| Q |
175 |
ggtttgtaaagggaaagaggaaaatctataaaaatataataatgtca |
221 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
14488475 |
ggtttgtaaagggaaaaaggaaaatctataaaaatataataatgtca |
14488429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University