View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15178_high_61 (Length: 235)
Name: NF15178_high_61
Description: NF15178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15178_high_61 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 164; Significance: 9e-88; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 30 - 193
Target Start/End: Original strand, 2748261 - 2748424
Alignment:
| Q |
30 |
taagaatggtatatgactttgtcccttgaaattacaaggtcagggctaatagacataatttcaataccttggcagtgcagtatccaactttttcatccgt |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2748261 |
taagaatggtatatgactttgtcccttgaaattacaaggtcagggctaatagacataatttcaataccttggcagtgcagtatccaactttttcatccgt |
2748360 |
T |
|
| Q |
130 |
gaatccgaatggatcatcaccaccgccaccgccaccaagaaggcgccgagcagtgccagaaaca |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2748361 |
gaatccgaatggatcatcaccaccgccaccgccaccaagaaggcgccgagcagtgccagaaaca |
2748424 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 85 - 126
Target Start/End: Original strand, 2756376 - 2756417
Alignment:
| Q |
85 |
taatttcaataccttggcagtgcagtatccaactttttcatc |
126 |
Q |
| |
|
||||||||||||||||||||| |||||||||| || |||||| |
|
|
| T |
2756376 |
taatttcaataccttggcagtacagtatccaatttcttcatc |
2756417 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University