View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15178_high_66 (Length: 220)
Name: NF15178_high_66
Description: NF15178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15178_high_66 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 15 - 203
Target Start/End: Complemental strand, 26102523 - 26102334
Alignment:
| Q |
15 |
caaaggtgtcataatatttagattggcatcgtggtgtcaatcgatctatcgtcaaaaaatatattactaatataataaaatggaagtcattcattttatc |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26102523 |
caaaggtgtcataatatttagattggcatcatggtctcaatcgatctatcgtcaaaaaatatattactaatataataaaatggaagtcattcattttatc |
26102424 |
T |
|
| Q |
115 |
aaaaatgtcatcggtttgacttttaatctcactaatttgat-agtttcatgtcaatttcttattttattttagtataataagatggaagt |
203 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26102423 |
aaaaatgccatcggtttgacttttaatctcactaatttgatgggtttcatgtcaatttcttattttattttagtataataagatggaagt |
26102334 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 116 - 152
Target Start/End: Original strand, 30929491 - 30929527
Alignment:
| Q |
116 |
aaaatgtcatcggtttgacttttaatctcactaattt |
152 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
30929491 |
aaaatgtcatcggttagacttttaatctcattaattt |
30929527 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University