View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15178_low_23 (Length: 407)
Name: NF15178_low_23
Description: NF15178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15178_low_23 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 376; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 376; E-Value: 0
Query Start/End: Original strand, 16 - 407
Target Start/End: Original strand, 31053357 - 31053748
Alignment:
| Q |
16 |
atactcagagaggaagtctggttttatgaaatggtttggcaagattttcaaaattggatccaatagaggaaggggtggtggtcatcttttacagcaacct |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31053357 |
atactcagagaggaagtctggttttatgaaatggtttggcaagattttcaaaattggatccaatagaggaaggggtggtggtcatcttttacagcaacct |
31053456 |
T |
|
| Q |
116 |
gtagacgaaaacatggcttggcgagctccgcctagatccttggtaccaatgactcaactatcttcttagtctcatttatagctcaatgataacattgttc |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
31053457 |
gtagacgaaaacatggcttggcgagctccgcctagatccttggtaccaatgactcaactatcttctttgtctcatttatagcttaatgataacattgttc |
31053556 |
T |
|
| Q |
216 |
tgtttaagaatatctatttagagtgtaggtcactgcgttaatttccccttatgtgtctataaaaaagctcctagatcaatgtactaaacaatattcttga |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31053557 |
tgtttaagaatatctatttagagtgtaggtcactgcgttaatttccgcttatgtgtctataaaaaagctcctagatcaatgtactaaacaatattcttga |
31053656 |
T |
|
| Q |
316 |
tgctaataggataaccgtgctagaactaagaaggaggaagaggatttgaacaatgcaattgcactttctttaagtgaagatttaaagatacc |
407 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31053657 |
tgctaataggataaccgtgctagaactaagaaggaggaagaggatttgaacaacgcaattgcactttctttaagtgaagatttaaagatacc |
31053748 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 21 - 101
Target Start/End: Complemental strand, 34745548 - 34745468
Alignment:
| Q |
21 |
cagagaggaagtctggttttatgaaatggtttggcaagattttcaaaattggatccaatagaggaaggggtggtggtcatc |
101 |
Q |
| |
|
||||||| ||||||||||| ||||||||| | | ||| |||||||| ||| ||||||||||||||| ||||| |||||| |
|
|
| T |
34745548 |
cagagagaaagtctggtttcatgaaatggctcagtaagcttttcaaaggtgggtccaatagaggaaggagtggtcgtcatc |
34745468 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University