View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15178_low_46 (Length: 280)
Name: NF15178_low_46
Description: NF15178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15178_low_46 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 16 - 263
Target Start/End: Original strand, 42323567 - 42323810
Alignment:
| Q |
16 |
atggatctatgatttagtggaacacaaagaactgcttgttttttcttaatcctccttattttaggtgaaagagacaatgaaaattcagaattctacttac |
115 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42323567 |
atggatctatgacctagtggaacacaaagaactgcttgttttttcttaatcctcctaattttaggtgaaagagacaatgaaaattcagaattctacttac |
42323666 |
T |
|
| Q |
116 |
tagaaggtaagaagagatttgtgaaagattgttttgagcatgaatcaaactcaaatacccaatttgttaaacattcactcaagttcattaacaatttgag |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
42323667 |
tagaaggtaagaagagatttgtgaaagattgttttgaccatgaatcaaactcaaatacccaatttgttaa----tcactcaagttcattaacaatttgag |
42323762 |
T |
|
| Q |
216 |
ttaaacacatgattagtgtttgcacctagagagcatgcatgtataaat |
263 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
42323763 |
ttaaacacatgattagtgtttgcacctaaagagcatgcatgtataaat |
42323810 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University