View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15178_low_62 (Length: 243)
Name: NF15178_low_62
Description: NF15178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15178_low_62 |
 |  |
|
| [»] scaffold0160 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0160 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: scaffold0160
Description:
Target: scaffold0160; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 18 - 220
Target Start/End: Original strand, 20337 - 20539
Alignment:
| Q |
18 |
cttctgatgacgatgatgaagacggtgctgactcagcttcaaaactaagttgaaccgttcgcgatgattcttcttcttgctttgtaacaagaaggttcat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20337 |
cttctgatgacgatgatgaagacggtgctgactcagcttcaaaactaagttgaaccgttcgcgatgattcttcttcttgctttgtaacaagaaggttcat |
20436 |
T |
 |
| Q |
118 |
catgtgagatctcatgtgaccccccaatgctcttccattgttgaagcttctatagcaaagtttgcacttgtatttatccataaaaggatgaaactaagaa |
217 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
20437 |
catatgagatctcatgtgaccccccaatgctcttccattgttaaagcttctatagcaaagtttgcacttgtatttatccataaaaggatgaaactaaaaa |
20536 |
T |
 |
| Q |
218 |
aac |
220 |
Q |
| |
|
||| |
|
|
| T |
20537 |
aac |
20539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University