View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15178_low_63 (Length: 243)
Name: NF15178_low_63
Description: NF15178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15178_low_63 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 20 - 224
Target Start/End: Original strand, 44490030 - 44490229
Alignment:
| Q |
20 |
aggagaaagaaaattgagaatgtagtagcaatagagaaggctttccaacccattgttataaaggacatgcaatattgcaatatagaaagagagctagcta |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
44490030 |
aggagaaagaaaattgagaatgtagtagcaatagagaaggctttccaacccattgttataaaggacatgcaatattgcaatatagaaagagagctatcta |
44490129 |
T |
 |
| Q |
120 |
gatttcaaaatttatatatgtagtggttggttggggtttgtgttggatttgagttcaattcgtgcaacacatgactatagtataggtgattctattatgg |
219 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
44490130 |
gatttcaaattttatatatgtagtggttggttggggtttgtgttggatttgagttcaattcgtgcaacacatgac-----tataggtgattctattatgg |
44490224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University