View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15179_high_6 (Length: 246)
Name: NF15179_high_6
Description: NF15179
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15179_high_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 1 - 176
Target Start/End: Original strand, 6695553 - 6695732
Alignment:
| Q |
1 |
attattgttttttggataaagagaatgctatgagtagcatgacc----ccaccggaaaggacaagttcaacaacttgacacatggaaagggatcaaattc |
96 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
6695553 |
attatttttttttggataaagagaatgctatgagtagcatgaccgaccccaccggaaaggacaagttcaacaacttgacacatggaaagggaccaaattc |
6695652 |
T |
 |
| Q |
97 |
aaaatgggtggtacacatggtgtggggatgcaaactgacctcgtatgtttctacataatgcattcagacatattgttggt |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6695653 |
aaaatgggtggtacacatggtgtggggatgcaaactgacctcgtatgtttctacataatgcattcagacatattgttggt |
6695732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University