View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15179_low_5 (Length: 270)

Name: NF15179_low_5
Description: NF15179
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15179_low_5
NF15179_low_5
[»] chr1 (1 HSPs)
chr1 (33-270)||(6695107-6695344)


Alignment Details
Target: chr1 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 33 - 270
Target Start/End: Original strand, 6695107 - 6695344
Alignment:
33 gaactcgatattcgatttttagaatcactcaacaatgatggtaaaacaacaaatgtttccctaccgaataaaagattggtcacataacggattcaattga 132  Q
    |||||||||||||||||| ||||||||||||||||| || ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
6695107 gaactcgatattcgatttctagaatcactcaacaataattgtaaaacaacaaatgtttccctaacgaataaaagattggtcacataacggattcaattga 6695206  T
133 cctaaaccccggagagaatttgaagtatagtcaaaagtcctcacactttgaaatcttgtacgatatctttgctacttagcatggatcactaatgcatgta 232  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6695207 cctaaaccccggagagaatttgaagtatagtcaaaagtcctcacactttgaaatcttgtacgatatctttgctacttagcatggatcactaatgcatgta 6695306  T
233 ttgtataatgcaattcaaaagttagttaattacagctt 270  Q
    ||| ||||| ||||||||||||||||||||||||||||    
6695307 ttgaataatacaattcaaaagttagttaattacagctt 6695344  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University