View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15179_low_5 (Length: 270)
Name: NF15179_low_5
Description: NF15179
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15179_low_5 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 33 - 270
Target Start/End: Original strand, 6695107 - 6695344
Alignment:
| Q |
33 |
gaactcgatattcgatttttagaatcactcaacaatgatggtaaaacaacaaatgtttccctaccgaataaaagattggtcacataacggattcaattga |
132 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| || ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
6695107 |
gaactcgatattcgatttctagaatcactcaacaataattgtaaaacaacaaatgtttccctaacgaataaaagattggtcacataacggattcaattga |
6695206 |
T |
 |
| Q |
133 |
cctaaaccccggagagaatttgaagtatagtcaaaagtcctcacactttgaaatcttgtacgatatctttgctacttagcatggatcactaatgcatgta |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6695207 |
cctaaaccccggagagaatttgaagtatagtcaaaagtcctcacactttgaaatcttgtacgatatctttgctacttagcatggatcactaatgcatgta |
6695306 |
T |
 |
| Q |
233 |
ttgtataatgcaattcaaaagttagttaattacagctt |
270 |
Q |
| |
|
||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
6695307 |
ttgaataatacaattcaaaagttagttaattacagctt |
6695344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University