View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1517_high_11 (Length: 329)
Name: NF1517_high_11
Description: NF1517
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1517_high_11 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 289; Significance: 1e-162; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 1 - 309
Target Start/End: Original strand, 32371905 - 32372213
Alignment:
| Q |
1 |
aaaatagcccaaatcgcagtaccgcctcacagtttattgaattctaagagttgtatcctaatatcttctctaatctctagtctttgtgtttctcttaaat |
100 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
32371905 |
aaaaaagcccaaatcgcagtaccgcctcacagtttattgaattctaagagttgtatcctaatatcttctctaatctctagtctttgtgtttctcttacat |
32372004 |
T |
 |
| Q |
101 |
ctctgtgtgatactgttgctttgtgtcatctctggctttcgtctcagacgagttgcactgtgttttttcggccttctcttgtgttcgcatgtcaggtttg |
200 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32372005 |
ctctgtgtgacactgttgctttgtgtcatctctggctttcgtctcagacgagttgcactgtgttttttcggccttctcttgtgttcgcatgtcaggtttg |
32372104 |
T |
 |
| Q |
201 |
tggtcctcttctcttttttcgtttgtctggtttgcaatgctttgtccagtctgatatgttcctcttttctattttgtctggctgtgtgatgctcttgttt |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
32372105 |
tggtcctcttctcttttttcgtttgtctggtttgcaatgctttgtccagtctgatgtgttcctcttttctattttgcctggctgtgtgatgctcttgttt |
32372204 |
T |
 |
| Q |
301 |
tgctctttg |
309 |
Q |
| |
|
||||||||| |
|
|
| T |
32372205 |
tgctctttg |
32372213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University