View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1517_low_16 (Length: 307)
Name: NF1517_low_16
Description: NF1517
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1517_low_16 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 18 - 297
Target Start/End: Original strand, 49171109 - 49171388
Alignment:
| Q |
18 |
ttctatcagcacacgtgtcgtgtttaagaatcgccacgccggttgaccagttgcccaggatcgatgctcagctggcagagtcgcagaatgttgttgccaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49171109 |
ttctatcagcacacgtgtcgtgtttaagaatcgccacgccggttgaccagttgcccaggatcgatgctcagctggcagagtcgcagaatgttgttgccaa |
49171208 |
T |
|
| Q |
118 |
gtactctgccttaggacaacagggcatgcttgataacgatgataataaacaactcgaccacttcatggtattttacttttctcaataataattacaaaat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49171209 |
gtactctgccttaggacaacagggcatgcttgataacgatgataataaacaactcgaccacttcatggtattttacttttctcaataataattacaaaat |
49171308 |
T |
|
| Q |
218 |
attgtgannnnnnnnnnnnaaagctttttgcgtgtcaattaatggatggaaatagatttgcaaaattttctgtctctgtg |
297 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
49171309 |
attgtgattttttttttttaaagctttttgcgtgtcaattaatggatggaaattgatttgcaaaattttctgtctctgtg |
49171388 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University