View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1517_low_19 (Length: 282)
Name: NF1517_low_19
Description: NF1517
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1517_low_19 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 8 - 266
Target Start/End: Original strand, 21613884 - 21614142
Alignment:
| Q |
8 |
agaaaagaaaggtagttgttgaaatggcagtcgatgttgagtgtgactcatattcactcaagtgtatgcaatttaagagtaaacttgtaaattaaatcct |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21613884 |
agaaaagaaaggtagttgttgaaatggcagtcgatgttgagtgtgactcatattcactcaagtgtatgcaatttaagagtaaacttgtaaattaaatcct |
21613983 |
T |
|
| Q |
108 |
agtatttaaacaatgcattgtgctttttaactcttaagaattgcatgctcaaagtttaacagccactagagtcataacacaatttgccaaactttatgat |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
21613984 |
agtatttaaacaatgcattgtgctttttaactcttaagaattgcatgctcaaagtttaacagccactagagtcataacacaatttgctaaactttatgat |
21614083 |
T |
|
| Q |
208 |
caatcgctactctagcaaggatcttgcaatctcatttgtttgtttcggaatgaacttaa |
266 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21614084 |
caatcgctactctagcaaggatcttgcaatctcatttgtttgtttcggaatgaacttaa |
21614142 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University