View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15180_high_3 (Length: 315)
Name: NF15180_high_3
Description: NF15180
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15180_high_3 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 18 - 305
Target Start/End: Complemental strand, 42884370 - 42884083
Alignment:
| Q |
18 |
ccttttgctctttttgagagtatatatattggataggacaggacatccttcatgtatctcttgtgactttcaagtctttgtgttcatttataagtgtctg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42884370 |
ccttttgctctttttgagagtatatatattggataggacaggacatccttcatgtatctcttgtgactttcaagtctttgtgttcatttataagtgtctg |
42884271 |
T |
|
| Q |
118 |
cgnnnnnnnnnnnnnnnngtcctcttcaattctctacatttaatattatagtacggtcctctatttattgcaactacgttaccaccttcttataacttct |
217 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
42884270 |
cgttttgtttttctttttgtcctcttcaattctctacatttaatattatagtaccgtcctctatttattgcaactacgttaccaccttcttataacttgt |
42884171 |
T |
|
| Q |
218 |
tcattgtcattactcatggcttctgattcttcttcttcaaagtgggtgatggaaaatggtgacattcctcatgttctggctgatgatg |
305 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
42884170 |
tcattgtcattactcatggcttctgattcttcttcttcaaagtgggtgatggaaaatggtgacattcctcatgttctggctgttgatg |
42884083 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 107; Significance: 1e-53; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 163 - 299
Target Start/End: Original strand, 22984414 - 22984547
Alignment:
| Q |
163 |
ttatagtacggtcctctatttattgcaactacgttaccaccttcttataacttcttcattgtcattactcatggcttctgattcttcttcttcaaagtgg |
262 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
22984414 |
ttatagtaccgtcctctatttattgcaactacgttatcaccttcttataacttcttcattgtcattactcatggcttctga---ttcttcttcaaagtgg |
22984510 |
T |
|
| Q |
263 |
gtgatggaaaatggtgacattcctcatgttctggctg |
299 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| |
|
|
| T |
22984511 |
atgatggaaaatggtgacattcctcatgttcttgctg |
22984547 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University