View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15180_high_4 (Length: 236)
Name: NF15180_high_4
Description: NF15180
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15180_high_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 23 - 220
Target Start/End: Complemental strand, 31831142 - 31830947
Alignment:
| Q |
23 |
tttggttgttttagaggccaatgaagggcatattttaaaatggtccttcaatttatggctctttggttattgtggtgttttggtttttgtac--ttgaga |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
31831142 |
tttggttgttttagaggccaatgaagggcatattttaaaatggtccttcaatttatggctctttggttattgtggtgttttggtttttgtacttttgaga |
31831043 |
T |
|
| Q |
121 |
tgnnnnnnngaccattctgctgttaatatagcagaaaggaactttttctttatatctttgtggtggaaactactaaattggaggaggtggaaatggatac |
220 |
Q |
| |
|
|| ||||||||||||||||||||||||||| ||||||||||||| |||||||||||| | ||||||||||||||||||||||||||||||||| |
|
|
| T |
31831042 |
tg-ttttttgaccattctgctgttaatatagcagaagggaactttttctt--tatctttgtggttg-aactactaaattggaggaggtggaaatggatac |
31830947 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University