View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15181_high_1_N (Length: 339)
Name: NF15181_high_1_N
Description: NF15181
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15181_high_1_N |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 177; Significance: 2e-95; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 21 - 213
Target Start/End: Complemental strand, 35508179 - 35507987
Alignment:
| Q |
21 |
atggggggttcggtgcgagacgtgaagtcaaagtcggagttggatgaggttgttcgcggcggttctccggcggtgcttcacttctgggggtcatggtgtg |
120 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
35508179 |
atgggtggttcggtgcgagacgtgaagtcaaagtcggagttggatgaggtggttcgcggcggttctccggcggtgcttcacttctgggcgtcatggtgtg |
35508080 |
T |
|
| Q |
121 |
aagcttccaaaaacatggaccaactcttctctcatttggccattgatttccctcatacccatttcttaagggttcggttttctttcccaatta |
213 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35508079 |
aagcttccaaacacatggaccaactcttctctcatttggccattgatttccctcatacccatttcttaagggttcggttttctttcccaatta |
35507987 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 280 - 331
Target Start/End: Complemental strand, 35507920 - 35507869
Alignment:
| Q |
280 |
ggttgaagctgaagaacaaccagagatatctgaggcttattctgtctctgct |
331 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35507920 |
ggttgaagctgaagaacaaccagagatatctgaggcttattctgtctctgct |
35507869 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University