View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15181_high_4 (Length: 320)
Name: NF15181_high_4
Description: NF15181
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15181_high_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 307; Significance: 1e-173; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 307; E-Value: 1e-173
Query Start/End: Original strand, 1 - 311
Target Start/End: Original strand, 51112661 - 51112971
Alignment:
| Q |
1 |
tctgcatagctttcgtcagcagcataatgtttggtcttttcagaagcatcagtggcataatctctgattttcttagaagcatcccaagcatagcctttgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51112661 |
tctgcatagctttcgtcagcagcataatgtttggtcttctcagaagcatcagtggcataatctctgattttcttagaagcatcccaagcatagcctttgg |
51112760 |
T |
|
| Q |
101 |
ttttctcagcagcatcatgggcatggtcactggctttttgagcagtttccttggacttgtgtgcagtttcatctgcatagtgtttggttttgtgtgcagc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51112761 |
ttttctcagcagcatcatgggcatggtcactggctttttgagcagtttccttggacttgtgtgcagtttcatctgcatagtgtttggttttgtgtgcagc |
51112860 |
T |
|
| Q |
201 |
gtctgaagcatattcagaggctttatcagtggtggtgctgtccttatctttgtctttgaagccaaggccttcggtgattttctctttggcccactcagtc |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51112861 |
gtctgaagcatattcagaggctttatcagtggtggtgctgtccttatctttgtctttgaagccaaggccttcggtgattttctctttggcccactcagtc |
51112960 |
T |
|
| Q |
301 |
catgtctctgc |
311 |
Q |
| |
|
||||||||||| |
|
|
| T |
51112961 |
catgtctctgc |
51112971 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University