View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15182_high_105 (Length: 205)
Name: NF15182_high_105
Description: NF15182
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15182_high_105 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 29 - 191
Target Start/End: Original strand, 8212343 - 8212505
Alignment:
| Q |
29 |
gccaaagctttcttctttgtctttggagaataaccggttcaccggtttaataccggttcagtttgcattgaaaacggtttttcctgaaattgggatggct |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8212343 |
gccaaagctttcttctttgtctttggagaataaccggttcaccggtttaataccggttcagtttgcattgaaaacggtttttcctgaaattgggatggct |
8212442 |
T |
|
| Q |
129 |
ccgtttgggaggcttttgttgggaggaaattatttgctcggtgggatacctcgtcctttgctt |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8212443 |
ccgtttgggaggcttttgttgggaggaaattatttgctcggtgggatacctcgtcctttgctt |
8212505 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 33 - 95
Target Start/End: Original strand, 38553969 - 38554031
Alignment:
| Q |
33 |
aagctttcttctttgtctttggagaataaccggttcaccggtttaataccggttcagtttgca |
95 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||| ||||| ||||| ||| |||||||| |
|
|
| T |
38553969 |
aagctttcatctttgtctttggagaataaccggttcactggtttgataccagtttagtttgca |
38554031 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University