View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15182_high_34 (Length: 401)
Name: NF15182_high_34
Description: NF15182
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15182_high_34 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 297; Significance: 1e-167; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 297; E-Value: 1e-167
Query Start/End: Original strand, 18 - 391
Target Start/End: Original strand, 28430841 - 28431218
Alignment:
| Q |
18 |
gttagcagtgaacaagatcaaatgcaggtatgtatctactatattagagtaattatgatcaatttttgaattctttttaggcttaattatcctattctca |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
28430841 |
gttagcagtgaacaagatcaaatgcaggtatgtatctactatattagagtaattatgatcaatttttcaattctttttaggcttaattatcctattctca |
28430940 |
T |
 |
| Q |
118 |
tagaaacggaccttcataatcgaccgaaatttgaactcaagttcaattaagatagaattaattccaatcactcgagttcggttgttacatgattactaga |
217 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28430941 |
tagaaacggaccttgataatcgaccgaaatttgaactcaagttcaattaagatagaattaactccaatcactcgagttcggttgttacatgattactaga |
28431040 |
T |
 |
| Q |
218 |
tccctctaaaaactaacgaaat--nnnnnnnnnttacatgaaggtgacaatacattta--tttattagcttgaaaccaaacacatttataatgtctcctt |
313 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28431041 |
tccctctaaagactaacgaaataaataaaaaatttacatgaaggtgaccatacatttatttttattagcttgaaaccaaacacatttataatgtctcctt |
28431140 |
T |
 |
| Q |
314 |
ctttctatttaggctgcaacgggcaccttggatggtatcgttgacacagtttccgccgtccatcctttgttacctttg |
391 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
28431141 |
ctttttatttaggctgcaacgggcaccttggatggtatcattgacacagtttctgccgtccatcctttgttacctttg |
28431218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University