View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15182_high_65 (Length: 298)
Name: NF15182_high_65
Description: NF15182
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15182_high_65 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 59 - 250
Target Start/End: Complemental strand, 28267973 - 28267781
Alignment:
| Q |
59 |
ttaattcaaagatttcgtcaactaaatatattcagaatggaaagagtagatgagtagatccttcgaaacttgaaatattgcagnnnnnnnnnnn-gttgc |
157 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
28267973 |
ttaattcaaagagttcgtcaactaaatatattcagaatggaaagagtagatgagtagatccttcgagacttgaaatattgcagttttttttttttgttgc |
28267874 |
T |
 |
| Q |
158 |
aggtcaatgcaaaaagagtgcaatagaaaatggaggaaaatcggatcaattttccgagaaaatcagtgaagaacaatcaaacttccttagaag |
250 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28267873 |
aggttaatgcaaaaagagtgcaatagaaaatggaggaaaatcggatcaattttccgagaaaatcagtgaagaacaatcaaacttccttagaag |
28267781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University