View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15182_high_66 (Length: 293)
Name: NF15182_high_66
Description: NF15182
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15182_high_66 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 239; Significance: 1e-132; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 32 - 274
Target Start/End: Original strand, 4777070 - 4777312
Alignment:
| Q |
32 |
ggtggagcgggaccattggtttcctgtaactgtaagaagcagaaagctatggattttgggtgcaaggacgttaatgtttggaaagaagcactttcaactt |
131 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4777070 |
ggtggagcgggaccattggtttcctgtaactgtaagaagcagaaagctatggattttgggtgcaaggacgttaatgtttggaaagaagcactttcaactt |
4777169 |
T |
 |
| Q |
132 |
acacatctcaagtacaatcactttctctctccaaaaacaaacccaatttagtttctcttaaccaattttattgcaatgaactaccttccctcattcacca |
231 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4777170 |
acacatctcaagtgcaatcactttctctctccaaaaacaaacccaatttagtttctcttaaccaattttattgcaatgaactaccttccctcattcacca |
4777269 |
T |
 |
| Q |
232 |
acgaaaccctaacccttttatcactacccaagaactctccaaa |
274 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4777270 |
acgaaaccctaacccttttatcactacccaagaactctccaaa |
4777312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 75 - 134
Target Start/End: Original strand, 4784644 - 4784703
Alignment:
| Q |
75 |
aagctatggattttgggtgcaaggacgttaatgtttggaaagaagcactttcaacttaca |
134 |
Q |
| |
|
|||||||||||||||| | ||||||||||| |||||||| ||||| ||||||||||||| |
|
|
| T |
4784644 |
aagctatggattttggattcaaggacgttagcgtttggaaggaagcgctttcaacttaca |
4784703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University