View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15182_high_75 (Length: 263)
Name: NF15182_high_75
Description: NF15182
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15182_high_75 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 8 - 248
Target Start/End: Complemental strand, 26030865 - 26030625
Alignment:
| Q |
8 |
gagcacagaacttgagacattaaatgaatctttgtagagtaaacataattgtacctggcatacacaaggcataacttgagcaatattgactagcttatcc |
107 |
Q |
| |
|
||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
26030865 |
gagcatagaacttgagacattaaatgaatcttcgtagagtaaacataattgtacctggcatacagaaggcataacttgagcaatattgactagcttatcc |
26030766 |
T |
 |
| Q |
108 |
agtttagtaagagtgaagttgcatattccaatgtctctaacaagattttccttgacaagcttctccatttctctccaaactccttccatgtcgaactccg |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26030765 |
agtttagtaagagtgaagttgcatattccaatgtctctaacaagattttccttgacaagcttctccatttctctccaaactccttccatgtcgaactccg |
26030666 |
T |
 |
| Q |
208 |
acacttctcctgctttaggaggcctgcttgccccatctttc |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26030665 |
acacttctcctgctttaggaggcctgcttgccccatctttc |
26030625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University