View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15182_high_77 (Length: 260)
Name: NF15182_high_77
Description: NF15182
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15182_high_77 |
 |  |
|
| [»] scaffold0098 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr5 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 255
Target Start/End: Original strand, 8212483 - 8212732
Alignment:
| Q |
1 |
gtgggatacctcgtcctttgcttgttcttaaacaagattctgctaatgtgagtttagttgataattgtttgtttaggtgtcctcatgttttcnnnnnnng |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
8212483 |
gtgggatacctcgtcctttgcttgttcttaaacaagattctgctaatgtcagtttagttgataattgtttgtttaggtgtcctcatgttttctttttttg |
8212582 |
T |
 |
| Q |
101 |
tcaaggtggaacacaaaaatcatcttttgaatgtagtagtgtaattattccttagtttattattttatgaatttctgatgatgatgatggtttttaattt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||| ||||||||||||||||| |
|
|
| T |
8212583 |
tcaaggtggaacacaaaaatcatcttttgaatgtagtagtgtaattattccttagt---ttattttatgaatttc---tgattatgatggtttttaattt |
8212676 |
T |
 |
| Q |
201 |
cattcatacatgtacacttttt-cttttggtcttatttctagctatcttctctgct |
255 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
8212677 |
cattcatacatgtacactttttccttttggtcttatttctagctatcttctctgct |
8212732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0098 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0098
Description:
Target: scaffold0098; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 212 - 240
Target Start/End: Complemental strand, 553 - 525
Alignment:
| Q |
212 |
gtacactttttcttttggtcttatttcta |
240 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
553 |
gtacactttttcttttggtcttatttcta |
525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University