View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15182_high_79 (Length: 253)
Name: NF15182_high_79
Description: NF15182
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15182_high_79 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
| [»] scaffold0032 (1 HSPs) |
| | |
|
Alignment Details
Target: chr6 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 1 - 253
Target Start/End: Complemental strand, 21006917 - 21006665
Alignment:
| Q |
1 |
ttaatctgattcaacatcttttgaatacgctgttttttcggatgagctttatacacaagacttacgcttaacttgtccttaccaacaatttgaacaatca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21006917 |
ttaatctgattcaacatcttttgaatacgctgttttttcggatgagctttatactcaagacttacgcttaacttgtccttaccaacaatttgaacaatca |
21006818 |
T |
|
| Q |
101 |
ggataagttatggagggagaaagcaagggaccagaattttattcattgggactgtaacacggcttattttcatagagttgcgaaaacccacgcactctct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21006817 |
ggataagttatggagggagaaagcaagggaccagaattttattcattgggactgtaacacggcttattttcatagagttgcgaaaacccacgcactctct |
21006718 |
T |
|
| Q |
201 |
aaaattatgtcggttttacatgatggggacaccgttattacatatgcttcagc |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21006717 |
aaaattatgtcggttttacatgatggggacaccgttattacatatgcttcagc |
21006665 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0032 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0032
Description:
Target: scaffold0032; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 97 - 181
Target Start/End: Original strand, 124884 - 124968
Alignment:
| Q |
97 |
atcaggataagttatggagggagaaagcaagggaccagaattttattcattgggactgtaacacggcttattttcatagagttgc |
181 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||| |||||||||||| || |||| || ||||| | |||||||| ||| |||| |
|
|
| T |
124884 |
atcaggatattttatggaaggagaaagcaagggatcagaattttattaatggggattgcaacacttcctattttcacagacttgc |
124968 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University