View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15182_high_82 (Length: 248)
Name: NF15182_high_82
Description: NF15182
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15182_high_82 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 232
Target Start/End: Original strand, 46410238 - 46410466
Alignment:
| Q |
1 |
ttcagatggttcgttaattatatgcgtgaaaacggggccttccaatggatttgaactttgaaggtcttgattattgtttaagcattatgtgaggtgctca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
46410238 |
ttcagatggttcgttaattatatgcgtgaaaacggggccttccaatggatttgaactttgaaggtcttgattattgtttaagcagtatgtgaggtgctca |
46410337 |
T |
|
| Q |
101 |
cattttgattccatatagcatgctgcagaatggtaaaagcaaagcaaacttgacatc-aaagctatgatttgattgaccaggaaaggaacaaaagatagt |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||| |||||||||||||||||||| |
|
|
| T |
46410338 |
cattttgattccatatagcatgctgcagaatggtaaaagcaaagcaaacttgacatcaaaagctatgat----ttgaccgggaaaggaacaaaagatagt |
46410433 |
T |
|
| Q |
200 |
cgaatttgtgggtataatgttgatgatgacatt |
232 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
46410434 |
cgaatttgtgggtataatgttgatgatgacatt |
46410466 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University