View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15182_high_84 (Length: 244)
Name: NF15182_high_84
Description: NF15182
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15182_high_84 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 18 - 236
Target Start/End: Original strand, 39745275 - 39745493
Alignment:
| Q |
18 |
tgttattttggggtgaatttgaaacctttgagtgaccctgatgatgttgcttttacactgttgcctaatatgggctactttgaattcattcctcttggac |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39745275 |
tgttattttggggtgaatttgaaacctttgagtgaccctgatgatgttgcttttacactgttgcctaatatgggctactttgaattcattcctcttggac |
39745374 |
T |
 |
| Q |
118 |
ataatgggacactgttgatggattttgatgaaaatgaacaagttcctaatgataagcttgtggatttagtgaatgtcaagattggttgcttttatgagct |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39745375 |
ataatgggacactgttgatggattttgatgaaaatgaacaagttcctaatgataagcttgtggatttagtgaatgtcaagattggttgcttttatgagct |
39745474 |
T |
 |
| Q |
218 |
agtcatcactacctttgct |
236 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
39745475 |
agtcatcactacctttgct |
39745493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University