View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15182_high_86 (Length: 240)
Name: NF15182_high_86
Description: NF15182
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15182_high_86 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 232
Target Start/End: Original strand, 28799239 - 28799469
Alignment:
| Q |
1 |
tttttcttagggttacgcttttcgattttcgattcaaccgcattttctgctacatgcttagttagtttcgtgtttatcacaatgtaatcgattttaacgt |
100 |
Q |
| |
|
|||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28799239 |
tttttcttagggttacacttttcgaatttcgattcaaccgcattttctgctacatgcttagttagtttcgtgtttatcacaatgtaatcgattttaacgt |
28799338 |
T |
 |
| Q |
101 |
ttaannnnnnnccgtgatttcaattttcaacatgtgaagattattaccgattattctgtgtttgtttatgttgaattgatttttccgcttattttttgca |
200 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
28799339 |
ttaatttttt-ccgtgatttcaattttcaacatgtgaagattattaccgattattctgtgtttgtttatgttgaattgatttttccgcttattttttgta |
28799437 |
T |
 |
| Q |
201 |
tacgttgtcagagttaacggaatgttcatttc |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
28799438 |
tacgttgtcagagttaacggaatgttcatttc |
28799469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University