View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15182_high_97 (Length: 224)
Name: NF15182_high_97
Description: NF15182
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15182_high_97 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 1 - 213
Target Start/End: Original strand, 10505005 - 10505216
Alignment:
| Q |
1 |
cggtcaagtgataaaggttaaagaatgtgttggtgacttgggcggaagccatgcgcctccaagcatggaatgctaattttaggcaaatgattggcttatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10505005 |
cggtcaagtgataaaggttaaagaatgtgttggtgacttgggcggaagccatgcacctccaagcatggaatgctaattttaggcaaatgattggcttatt |
10505104 |
T |
|
| Q |
101 |
agttggtgagttttgtaaacaagaaaacaaaaatagttggtgagttctaaaatactagacnnnnnnnnnagcaaaaaacactagacttgttgtgattaga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| | ||||||| ||||||||||||||||||||| |
|
|
| T |
10505105 |
agttggtgagttttgtaaacaagaaaacaaaaatagttggtgagttataaaatactagac-ctttttttatcaaaaaatactagacttgttgtgattaga |
10505203 |
T |
|
| Q |
201 |
aaaatggtatatt |
213 |
Q |
| |
|
||||||||||||| |
|
|
| T |
10505204 |
aaaatggtatatt |
10505216 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University