View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15182_low_111 (Length: 218)

Name: NF15182_low_111
Description: NF15182
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15182_low_111
NF15182_low_111
[»] chr4 (1 HSPs)
chr4 (13-201)||(47201076-47201264)


Alignment Details
Target: chr4 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 13 - 201
Target Start/End: Original strand, 47201076 - 47201264
Alignment:
13 gaagaatattgtggaagagcgattttggcgaatccaaacgatggtaacgttttatcactttacgcagatttgatatgggagtgtcataaggatgctcctc 112  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47201076 gaagaatattgtggaagagcgattttggcgaatccaaacgatggtaacgttttatcactttacgcagatttgatatgggagtgtcataaggatgctcctc 47201175  T
113 gtgctgagacatattttgatcaagcagttaaagcagctcctgatgactggtaataattcatttcaagcaaagtttcatatgctaaaatt 201  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47201176 gtgctgagacatattttgatcaagcagttaaagcagctcctgatgactggtaataattcatttcaagcaaagtttcatatgctaaaatt 47201264  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University