View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15182_low_112 (Length: 215)
Name: NF15182_low_112
Description: NF15182
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15182_low_112 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 16 - 202
Target Start/End: Complemental strand, 1935726 - 1935540
Alignment:
| Q |
16 |
atactatgtccaaatgagagtctaactgtggttgccgtgaaactattaatttacaggtataagttattggatattttactgaattcaaaaccttgtggga |
115 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1935726 |
atactatgtccaaatgagagtctaactgcggttgccgtgaaactattaatttacaggtatacgttattggatattttactgaattcaaaaccttgtggga |
1935627 |
T |
|
| Q |
116 |
agaattggaaacgctgtaggccaattctataatgcatgcgtggagtaccacatgcatgtttggccatgagcaagtcactgttgtttc |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1935626 |
agaattggaaacgctgtaggccaattctataatgcatgtgtggagtaccacatgcatgtttggccatgagcaagtcactgttgtttc |
1935540 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University