View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15182_low_115 (Length: 207)
Name: NF15182_low_115
Description: NF15182
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15182_low_115 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 174; Significance: 8e-94; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 174; E-Value: 8e-94
Query Start/End: Original strand, 1 - 174
Target Start/End: Original strand, 28799574 - 28799747
Alignment:
| Q |
1 |
ctttttatgattggtttgaatttgaataatgatgaagttttcacacagaattgaaaatcatattagtgcttgttgtgattcagtagcaaaatgttgatgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28799574 |
ctttttatgattggtttgaatttgaataatgatgaagttttcacacagaattgaaaatcatattagtgcttgttgtgattcagtagcaaaatgttgatgt |
28799673 |
T |
|
| Q |
101 |
gctgtgttttggaccaatgagtttcactcgttatggtgcattctgagtaggtttatcatttgtggctgactttt |
174 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28799674 |
gctgtgttttggaccaatgagtttcactcgttatggtgcattctgagtaggtttatcatttgtggctgactttt |
28799747 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University