View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15182_low_116 (Length: 205)

Name: NF15182_low_116
Description: NF15182
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15182_low_116
NF15182_low_116
[»] chr5 (1 HSPs)
chr5 (29-191)||(8212343-8212505)
[»] chr2 (1 HSPs)
chr2 (33-95)||(38553969-38554031)


Alignment Details
Target: chr5 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 29 - 191
Target Start/End: Original strand, 8212343 - 8212505
Alignment:
29 gccaaagctttcttctttgtctttggagaataaccggttcaccggtttaataccggttcagtttgcattgaaaacggtttttcctgaaattgggatggct 128  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8212343 gccaaagctttcttctttgtctttggagaataaccggttcaccggtttaataccggttcagtttgcattgaaaacggtttttcctgaaattgggatggct 8212442  T
129 ccgtttgggaggcttttgttgggaggaaattatttgctcggtgggatacctcgtcctttgctt 191  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8212443 ccgtttgggaggcttttgttgggaggaaattatttgctcggtgggatacctcgtcctttgctt 8212505  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 33 - 95
Target Start/End: Original strand, 38553969 - 38554031
Alignment:
33 aagctttcttctttgtctttggagaataaccggttcaccggtttaataccggttcagtttgca 95  Q
    |||||||| ||||||||||||||||||||||||||||| ||||| ||||| ||| ||||||||    
38553969 aagctttcatctttgtctttggagaataaccggttcactggtttgataccagtttagtttgca 38554031  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University