View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15182_low_118 (Length: 201)
Name: NF15182_low_118
Description: NF15182
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15182_low_118 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 174; Significance: 8e-94; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 174; E-Value: 8e-94
Query Start/End: Original strand, 1 - 201
Target Start/End: Original strand, 21157920 - 21158123
Alignment:
| Q |
1 |
ttatcgacatcaacccacactcgtgctcatcaaaaggtataaattcattgcaccaacatttggtaaaagctggctttttgtaatgtttcctgaaagtagg |
100 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21157920 |
ttatcgacatcaacccacactcctgctcatcaaaaggtataaattcattgcaccaacattaggtaaaagctggctttttgtaatgtttcctgaaagtagg |
21158019 |
T |
 |
| Q |
101 |
taacctagtcaacattgttcttttgtttatttggattggattgcatatttatttatttatttggataaaaagtggactgca---taggtataaattttgg |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
21158020 |
taacctagtcaacattgttcttttgtttatttgggttggattgcatatttatttatttttttggataaaaagtggactgcatattaggtataaattttgg |
21158119 |
T |
 |
| Q |
198 |
ttgt |
201 |
Q |
| |
|
|||| |
|
|
| T |
21158120 |
ttgt |
21158123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University