View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15182_low_13 (Length: 584)
Name: NF15182_low_13
Description: NF15182
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15182_low_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 340; Significance: 0; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 340; E-Value: 0
Query Start/End: Original strand, 206 - 577
Target Start/End: Original strand, 48310078 - 48310449
Alignment:
| Q |
206 |
aaactcatgcacaaggttgtcaaaaacgcgatcttacaatattatagtctttaatgacttgggcgatcccgatcacggttaaaatcacaatttagcagga |
305 |
Q |
| |
|
|||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48310078 |
aaactcatacacaaggttgtcaaaatcgcgatcttacaatattatagtctttaatgacttcggcgatcccgatcacggttaaaatcacaatttagcagga |
48310177 |
T |
 |
| Q |
306 |
tcacatgggattgtagatcttactcgtgaaattggtcggattgtttgcaaacatcaaccaggttcatgggttggacgccacgacaccgttgacaacaaca |
405 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48310178 |
tcacatgggattgtagatcttactcgtgaaattggtgggattgtttgcgaacatcaaccaggttcatgggttggacgccacgacaccgttgacaacaaca |
48310277 |
T |
 |
| Q |
406 |
tttttctgtgttaaaatgtggctgttcttttgacagagtttgggttctcggacgtctgttatggaagcttccttcggccgagtttttctccttgtgtatg |
505 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
48310278 |
tttttctgtgttaaaatgtggctgttcttttgacagagtttgggttctcggacgtctgttatggaagcttccctcggccgtgtttttctccttgtgtatg |
48310377 |
T |
 |
| Q |
506 |
attttctcgttgatttcaaatttatgtttatttaagttattccaatttaaatggttttccttacctatgcta |
577 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
48310378 |
attttctcgttgatttcaaatttatgtttatttaagttattccaatttaaatggttttccttacttatgcta |
48310449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 75; E-Value: 3e-34
Query Start/End: Original strand, 49 - 127
Target Start/End: Original strand, 48309921 - 48309999
Alignment:
| Q |
49 |
tgtgcaatgacactttattattatgatttgctttttaagtgagttggaatgatgaagatttggtgttaatttcgatacc |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48309921 |
tgtgcaatgacactttattattatgatttgctttataagtgagttggaatgatgaagatttggtgttaatttcgatacc |
48309999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 18 - 52
Target Start/End: Original strand, 48309879 - 48309913
Alignment:
| Q |
18 |
tccacattacgaacttttgttttggtaattttgtg |
52 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| |
|
|
| T |
48309879 |
tccacattatgaacttttgttttggtaattttgtg |
48309913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University