View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15182_low_45 (Length: 372)
Name: NF15182_low_45
Description: NF15182
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15182_low_45 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 339; Significance: 0; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 339; E-Value: 0
Query Start/End: Original strand, 1 - 366
Target Start/End: Complemental strand, 21007313 - 21006950
Alignment:
| Q |
1 |
gttctggctctttatttacttagtttaatgggagctttggcacatacaatatggcaatccgtcttgatcgcgctatttgtaatgagagttggttgaattt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21007313 |
gttctggctctttatttacttagtttaatgggagttttggcacatacaatatggcaatccgtcttgatcgcgctatttgtaatgagagttggttgaattt |
21007214 |
T |
 |
| Q |
101 |
ttggtgccattccacttgttgtgccttatagttcgtcaccaattagatcaccatcctttattattatcgttggactattccgatgtgcaccataccacac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21007213 |
ttggtgccattccacttgttgtgcctta--gttcgtcaccaattagatcaccatcctttattattatcgttggactattccgatgtgcaccataccacac |
21007116 |
T |
 |
| Q |
201 |
cgtttaaaattttcaaatcatggtccacccatgatgaccgccgcaagctagtgtctgattcttgggtaaaaaatgtttgtggtactggaatgcttcgttt |
300 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
21007115 |
cgtttaaatttttcaaatcatggtccacccatgatgaccgccgcaagctagtgtctgattcttggggaaaaaatgtttgtggtactggaatgcttcgttt |
21007016 |
T |
 |
| Q |
301 |
ggaattaaaattgaaaaatttgaatcaagtttttcaacattggaatcagactgtttttgatgatgt |
366 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
21007015 |
ggaattaaaattgaaaaatttgaatcaagtttttcaacattggaatcagactgtttttggtgatgt |
21006950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University