View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15182_low_56 (Length: 335)
Name: NF15182_low_56
Description: NF15182
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15182_low_56 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 283; Significance: 1e-158; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 16 - 326
Target Start/End: Complemental strand, 2730767 - 2730457
Alignment:
| Q |
16 |
caaggaggagaagagtatggcttcaagtgtttggaatcccccttcatgcatgagaggaagggttcttcaagcttcttgattcaaagttcagtgaattcat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
2730767 |
caaggaggagaagagtatggcttcaagtgtttggaatcccccttcatgcatgagaggaagggttcttcaaccttcttgattcaaagttcagagaattcat |
2730668 |
T |
|
| Q |
116 |
agattttacggtgatacaattcaaaggaaccatctagatgtggcatagatcctagtgtttttctcttaaaacggggttgataggtggatctttcaccatt |
215 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
2730667 |
agattttacagtgatacaattcaaaggaaccatctagatgtggcatagatcctagtgtttttctcttaaaatggggttaataggtggatctttcaccatt |
2730568 |
T |
|
| Q |
216 |
tcaattgtaggtaaaaggtacaagatatgggtgaaggaagaagatttacggtggatgaatgggcggaggaacaacggtgaaggtagttcgattgagggtg |
315 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
2730567 |
tcaattgtaggtataaggtacaagatatgggtgaaggaagaagatttacggtggatgaatgggcggaggaacaacagtgaaggtagttcgattgagggtg |
2730468 |
T |
|
| Q |
316 |
atggttcatct |
326 |
Q |
| |
|
||||||||||| |
|
|
| T |
2730467 |
atggttcatct |
2730457 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University