View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15182_low_63 (Length: 313)
Name: NF15182_low_63
Description: NF15182
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15182_low_63 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 123 - 303
Target Start/End: Original strand, 2750920 - 2751100
Alignment:
| Q |
123 |
gagagtcttcctgagagtcttccttcatttggcatacttgtttacatttcaacatcacaataggccctttcaaaactcttagctttagaaaaattcacca |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2750920 |
gagagtcttcctgagagtcttccttcatttggcatacttgtttacatttcaacatcacaataggccctttcaaaactcttagctttagaaaaattcacca |
2751019 |
T |
 |
| Q |
223 |
acacaggtgaacaagatatctttagagtacggtgtcttgttttcaacaatccaaccttaaaccttatccttgctctgatga |
303 |
Q |
| |
|
||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2751020 |
gcacgggtgaacaagatatccttagagtacggtgtcttgttttcaacaatccaaccttaaaccttatccttgctctgatga |
2751100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University