View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15182_low_75 (Length: 292)
Name: NF15182_low_75
Description: NF15182
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15182_low_75 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 151; Significance: 6e-80; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 151; E-Value: 6e-80
Query Start/End: Original strand, 53 - 203
Target Start/End: Complemental strand, 17057808 - 17057658
Alignment:
| Q |
53 |
atcttgttttttgcaggacaataattatgttctatgcagatttagaaagaattgcactcacttacctgtaagcaaaaatatcgttgcacaagataaacca |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17057808 |
atcttgttttttgcaggacaataattatgttctatgcagatttagaaagaattgcactcacttacctgtaagcaaaaatatcgttgcacaagataaacca |
17057709 |
T |
 |
| Q |
153 |
agaaagatagtcgttcctgaacctgcggcaatcaccatacctgtaagttac |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17057708 |
agaaagatagtcgttcctgaacctgcggcaatcaccatacctgtaagttac |
17057658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 224 - 282
Target Start/End: Complemental strand, 17057661 - 17057603
Alignment:
| Q |
224 |
ttaccaaaagatttgatggttttattcctatactgtattattattgtttttctcctttg |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
17057661 |
ttaccaaaagatttgatggttttattcctatactgtattattattgtttttctcgtttg |
17057603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 59 - 105
Target Start/End: Original strand, 6044892 - 6044938
Alignment:
| Q |
59 |
ttttttgcaggacaataattatgttctatgcagatttagaaagaatt |
105 |
Q |
| |
|
||||||||||||||| |||||||||||||||| ||| |||||||||| |
|
|
| T |
6044892 |
ttttttgcaggacaacaattatgttctatgcaaattcagaaagaatt |
6044938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 59 - 104
Target Start/End: Complemental strand, 22598487 - 22598442
Alignment:
| Q |
59 |
ttttttgcaggacaataattatgttctatgcagatttagaaagaat |
104 |
Q |
| |
|
||||||| ||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
22598487 |
ttttttgtaggccaacaattatgttctatgcagatttagaaagaat |
22598442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 59 - 108
Target Start/End: Complemental strand, 17637460 - 17637411
Alignment:
| Q |
59 |
ttttttgcaggacaataattatgttctatgcagatttagaaagaattgca |
108 |
Q |
| |
|
||||||||||| ||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
17637460 |
ttttttgcaggccaacaattatgttctatgcagatttcaaaagaattgca |
17637411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University