View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15182_low_82 (Length: 270)
Name: NF15182_low_82
Description: NF15182
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15182_low_82 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 19 - 253
Target Start/End: Original strand, 43290454 - 43290688
Alignment:
| Q |
19 |
tgaaactgtggctgttaatttagtttcctatttaaacaaaatgagttgtttgttgaaaataactgacacattgggatttgttcattctcttaacccttcc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43290454 |
tgaaactgtggctgttaatttagtttcctatttaaacaaaatgagttgtttgttgaaaataactgacacattgggatttgttcattctcttaacccttcc |
43290553 |
T |
|
| Q |
119 |
attgttgtgattgttgaacaagaaggtagtaaaaatcctagtagaaccttcttatcaagattcacagacacattgcattattttgcagctatgtttgatt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43290554 |
attgttgtgattgttgaacaagaaggtagtaaaaatcctagtagaaccttcttatcaagattcacagacacattgcattattttgcagctatgtttgatt |
43290653 |
T |
|
| Q |
219 |
cacttgatgattgtttaccacttgagagtattgag |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
43290654 |
cacttgatgattgtttaccacttgagagtattgag |
43290688 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University