View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15182_low_85 (Length: 263)
Name: NF15182_low_85
Description: NF15182
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15182_low_85 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 41 - 231
Target Start/End: Complemental strand, 40360502 - 40360312
Alignment:
| Q |
41 |
ggaagatttttataccaaggatctccgagtttcagaatttattgcaccgaagctgatacaaggaaggaagaggaagaagaagaatgtaagagttcaaaca |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40360502 |
ggaagatttttataccaaggatctccgagtttcagaatttattgcaccgaagctgatacaaggaaggaagaggaagaagaagaatgtaagagttcaaaca |
40360403 |
T |
 |
| Q |
141 |
ttgttgtcatgcaccaaaaatcacgtagtgctgacagtgttgttcaaagtgttgcagcaaggaaaacaaaaatctcaaacgaggtaatcaa |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40360402 |
ttgttgtcatgcaccaaaaatcacgtagtgctgacagtgttgttcaaagtgttgcagcaaggaaaacaaaaatctcaaacgaggtaatcaa |
40360312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University