View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15183_high_16 (Length: 339)
Name: NF15183_high_16
Description: NF15183
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15183_high_16 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 285; Significance: 1e-160; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 285; E-Value: 1e-160
Query Start/End: Original strand, 24 - 320
Target Start/End: Complemental strand, 41678584 - 41678288
Alignment:
| Q |
24 |
tagcaactcttctcactccatccaccttcagtggagtcaatttcaccggcgacggatccaacccatcacgacggtttctcctaaacgggtcaggacccga |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41678584 |
tagcaactcttctcactccatccaccttcaggggagtcaatttcaccggcgacggatccaacccatcacgacggtttctcctaaacgggtcaggacccga |
41678485 |
T |
|
| Q |
124 |
atcaaccctttgctgggtacgcagcttcggagaaagagaaactgaaacatgatcttcttcgcgctgtctgaactgcatagttgttaattgagtaaacaaa |
223 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41678484 |
atcaaccctttgctgggtacgcagctttggagaaagagaaactgaaacatgatcttcttcgcgctgtctgaactgcatagttgttaattgagtaaacaaa |
41678385 |
T |
|
| Q |
224 |
agtaaaccctaaatacccttttggttgaatttaggaataaatcgagaaaaaagggaaattttgtaaaagggaaaaaccctagtgatcttgaaaacct |
320 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41678384 |
agtaaaccctaaatacccttttggttgaatttaggaataaatcgagaaaaaaaggaaattttgtaaaagggaaaaaccctagtgatcttgaaaacct |
41678288 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University