View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15183_high_25 (Length: 236)
Name: NF15183_high_25
Description: NF15183
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15183_high_25 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 104; Significance: 6e-52; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 1 - 108
Target Start/End: Original strand, 40367416 - 40367523
Alignment:
| Q |
1 |
tctaccacgatcagcctatgtttatgtttggttttaggtcctaaaattgatttcacctctaaatccaattttattcaaaatcttagaattttagttttta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
40367416 |
tctaccacgatcagcctatgtttatgtttggttttaggtcctaaaattgatttcacctctaaatccaattttattcaaaatcttagaattctagttttta |
40367515 |
T |
 |
| Q |
101 |
cggtgaca |
108 |
Q |
| |
|
|||||||| |
|
|
| T |
40367516 |
cggtgaca |
40367523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University