View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15183_high_25 (Length: 236)

Name: NF15183_high_25
Description: NF15183
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15183_high_25
NF15183_high_25
[»] chr8 (1 HSPs)
chr8 (1-108)||(40367416-40367523)


Alignment Details
Target: chr8 (Bit Score: 104; Significance: 6e-52; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 1 - 108
Target Start/End: Original strand, 40367416 - 40367523
Alignment:
1 tctaccacgatcagcctatgtttatgtttggttttaggtcctaaaattgatttcacctctaaatccaattttattcaaaatcttagaattttagttttta 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
40367416 tctaccacgatcagcctatgtttatgtttggttttaggtcctaaaattgatttcacctctaaatccaattttattcaaaatcttagaattctagttttta 40367515  T
101 cggtgaca 108  Q
    ||||||||    
40367516 cggtgaca 40367523  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University