View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15184_high_10 (Length: 239)
Name: NF15184_high_10
Description: NF15184
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15184_high_10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 18 - 226
Target Start/End: Original strand, 30541256 - 30541463
Alignment:
| Q |
18 |
caatgtgcatatttatcttgttaacatagcacttgatctatataataacttnnnnnnnnnnntatagtaagttatacaataattgattaacaatttcaat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
30541256 |
caatgtgcatatttatcttgttaacatagcacttgatctatataataa-tttaaaaaatatatatagtaagttataaaataattgattaacaatttcaat |
30541354 |
T |
|
| Q |
118 |
gaaaaactaactcaatatatacatcctactacatttggatcaaaggttataacccaatatagctagcaacatagccacaatcttaacaccatccaattcc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30541355 |
gaaaaactaactcaatatatacatcctactacatttggatcaaaggttataacccaatatagctagcaacatagccacaatcttaacaccatccaattcc |
30541454 |
T |
|
| Q |
218 |
tcatggcct |
226 |
Q |
| |
|
||||||||| |
|
|
| T |
30541455 |
tcatggcct |
30541463 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University