View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15184_low_12 (Length: 238)
Name: NF15184_low_12
Description: NF15184
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15184_low_12 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 18 - 211
Target Start/End: Original strand, 48956950 - 48957143
Alignment:
| Q |
18 |
aaacactttaatgctggatccatacttctaggatttggtgtctttgaggctgttggtggtggactcaacacatggttaaggacaggaaagctatttccag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48956950 |
aaacactttaatgctggatccatacttctaggatttggtgtctttgaggctgttggtggtggactcaacacatggttaaggacaggaaagctatttccag |
48957049 |
T |
|
| Q |
118 |
gtccacatttatttgcaggagcaggtaattaaacactaaattcacatttgtttcaagagcaaagtacacataccttccttccccttgagctatt |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
48957050 |
gtccacatttatttgcaggagcaggtaattaaacactaaattcgcatttttttcaagagcaaagtacacatacctcccttccccttgagctatt |
48957143 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University