View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15187_low_6 (Length: 230)

Name: NF15187_low_6
Description: NF15187
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15187_low_6
NF15187_low_6
[»] chr6 (1 HSPs)
chr6 (18-108)||(1920012-1920103)


Alignment Details
Target: chr6 (Bit Score: 80; Significance: 1e-37; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 18 - 108
Target Start/End: Original strand, 1920012 - 1920103
Alignment:
18 ttcatatgattaagaaaacaaataa-caaacatcattcatttgattcagaatttccaaaaagtggtaaattcaattctagtacttttctttt 108  Q
    |||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1920012 ttcatatgattaagaaaataaataaacaaacatcattcatttgattcagaatttccaaaaagtggtaaattcaattctagtacttttctttt 1920103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University