View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15188_high_19 (Length: 246)
Name: NF15188_high_19
Description: NF15188
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15188_high_19 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 67; Significance: 7e-30; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 157 - 227
Target Start/End: Complemental strand, 43017127 - 43017057
Alignment:
| Q |
157 |
tttttaaggatctatcacaacgattcaggtctcacatcaagtatattgaggattctacaaccacaatgtca |
227 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
43017127 |
tttttaaggatctatcacaacgattcaggtctcacatcaagtatattgatgattctacaaccacaatgtca |
43017057 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 34 - 85
Target Start/End: Complemental strand, 43017181 - 43017130
Alignment:
| Q |
34 |
actggaaagaacaggttgtgaatttaaagaaatcatggagtaaaagtagttc |
85 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
43017181 |
actggaaagaacaggttgtgaatttaaagaaatcatgaagtaaaaatagttc |
43017130 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University