View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15188_high_21 (Length: 238)
Name: NF15188_high_21
Description: NF15188
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15188_high_21 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 20 - 223
Target Start/End: Complemental strand, 41688526 - 41688323
Alignment:
| Q |
20 |
taaggttctaacatgtcaactaacttactcctggaatataactattatatatcatagcaagctgcgagataaatacttgattcattcttcgatcgagctg |
119 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
41688526 |
taaggtactaacatgtcaactaacttactcctggaatataactattatatatcatagcaagctgcgagataaatacttgattcattcttcgatcaagctg |
41688427 |
T |
 |
| Q |
120 |
gtttcataagaattcgtatttttgttctgcgtagtttgaaatgattattctattcacgcactcctaggatttgtggtgtttttaatattcacaccaagta |
219 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41688426 |
gtttcataagaatgcgtatttttgtcctgcgtagtttgaaatgattattctattcacgcactcctaggatttgtggtgtttttaatattcacaccaagta |
41688327 |
T |
 |
| Q |
220 |
tctg |
223 |
Q |
| |
|
|||| |
|
|
| T |
41688326 |
tctg |
41688323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University