View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15188_high_22 (Length: 234)
Name: NF15188_high_22
Description: NF15188
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15188_high_22 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 119; Significance: 6e-61; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 20 - 181
Target Start/End: Complemental strand, 48842614 - 48842452
Alignment:
| Q |
20 |
gtatacgtaggtctgaaaagatagttaattgccattccccaacgaacgatcgttaactgctaccggagataaaatggtcagttcaagatgtataccatga |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
48842614 |
gtatacgtaggtctgaaaagatagttaattgccgttccccaacgaacgatcgttaaccgctactggagataaaatggacagttcaagatgtataccatga |
48842515 |
T |
|
| Q |
120 |
gtgctaaacaacaaactttggtgtgtttttggat-gattgttcatcattcgtagaatgcgaga |
181 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||| ||| | ||||||||| |
|
|
| T |
48842514 |
ttgctaaacaacaaactttggtgtgtttttggatggattgttcatccctcggaaaatgcgaga |
48842452 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University